bubble_chart Overview

Genital herpes is one of the sexually transmitted diseases caused by herpes simplex virus type I and type II. The incidence rate has significantly increased in recent years. Herpes simplex virus can cause infections of the skin, mucous membranes, and various organs. It can lead to genital herpes through sexual contact.

bubble_chart Epidemiology

The current prevalence of genital herpes is highly notable among STDs, having become one of the most common sexually transmitted diseases in Europe and America. For instance, in the UK, cases rose from 4,000 in 1971 to 20,000 in 1985. In the United States, cases increased 15-fold between 1966 and 1984. It is estimated that the cumulative number of cases in the U.S. exceeds 30 million. This disease ranks fifth among STDs (7.7%). In European and American countries, it accounts for 5–10% of cases, particularly due to the recent diversification of sexual behaviors and the widespread practice of oral sex, leading to a relative increase in genital infections originating from oral HSV transmission. Another contributing factor is the lack of immunity to HSV, resulting in higher infection rates among adults. HSV-2 is the primary pathogen of genital herpes, responsible for 90% of cases, while HSV-1 accounts for the remaining 10%. The prevalence of HSV-2 has risen significantly worldwide. Among clinically observed genital herpes patients, the youngest was a 16-year-old female, and the oldest was a 69-year-old male. The highest incidence occurs in the 20–30 age group for both genders, with rates of 38% (male) and 52% (female), respectively. Among U.S. college students, the seroprevalence of HSV-2 is only 2–4%, whereas it reaches 25–30% among those visiting family clinics. Over the past decade, the seroprevalence of HSV-2 in the general U.S. population has increased by one-third, reaching 23%. In developing countries, HSV-2 seroprevalence is even higher—for example, 41% among women attending health clinics in Uganda and 83% at STD centers in Peru. In China, genital herpes cases have also risen significantly in recent years, though detailed incidence statistics are lacking.

HSV infection is widespread in the population, with humans being the natural host of the herpes virus. The primary source of infection is genital herpes patients and asymptomatic virus carriers. Tracing the source of infection in males, nearly half are attributed to prostitution, while the rest stem from various forms of promiscuous and unprotected sexual activity. Genital herpes patients contract the disease through sexual contact with partners, who are often unaware they are infected. This is one of the reasons for the widespread dissemination of genital herpes.

HSV-1 is commonly transmitted through droplets and saliva, whereas HSV-2 is almost exclusively spread via sexual contact.

bubble_chart Pathogen

Herpes simplex virus belongs to the virus family, with a diameter of 180nm, making it a relatively large DNA virus. It can be divided into two subtypes, HSV-1 and HSV-2, which differ in terms of biology, natural properties, and human immune responses. However, the pathophysiological effects caused by infections from these two subtypes are the same. The nucleic acid structure of HSV consists of double-stranded linear DNA, with each strand divided into long and short segments. The molecular weight is approximately 100×10^6 daltons, with 150,000 base pairs, capable of encoding over 60 gene products. Among DNA viruses, the genetic structure of herpes simplex virus is unique because its two independent nucleotide sequences are flanked by inverted repeat sequences, allowing these sequences to interconnect in an inverted manner. The viral DNA has four isomers. HSV-1 and HSV-2 share about 50% genetic homology.

The morphology of HSV is spherical, with the viral nucleocapsid surface forming a symmetrical icosahedron (100–110nm) composed of 162 capsomeres. Inside is a core made of DNA, surrounded by a protein shell that encases the viral genome, and an outer lipid membrane. Between the capsid and the envelope is a tegument composed of multiple proteins. HSV has three classes of genes: α, β, and γ. HSV infects nerve cells without causing cell death; the virus remains in a suppressed state within the infected cells, and the survival and function of the infected cells are unaffected. This process is called latency. When viral genes are activated, the virus begins to replicate, sometimes forming herpetic lesions—a process termed recurrence. During latent infection, the nuclei of infected neurons contain large amounts of two RNA transcripts that overlap with the immediate-early (α) gene product called ICP-O. These RNA transcripts are encoded in the "antisense" direction, suggesting they may act as inhibitors of β and γ protein transcription. When the virus is in a latent state, its ability to reactivate is also reduced. Understanding the molecular mechanisms of viral latency may help identify new approaches to prevent HSV recurrence.

bubble_chart Pathogenesis

HSV primarily enters the human body through the skin, mucous membranes, or broken areas, initially replicating in epidermal or dermal cells. Regardless of clinical symptoms, after sufficient local replication, the virus infects sensory or autonomic nerve endings. The virus then travels along nerve axons to reach nerve cells within ganglia. Animal experiments have shown that it takes about two days for the virus to be detected in nerve cells of ganglia after skin or mucous membrane inoculation with HSV, indicating a remarkably rapid infection rate.

HSV-1 is typically transmitted through close contact via the respiratory tract, digestive tract, or skin and mucous membranes. Therefore, HSV-1 often latently resides in the trigeminal nerve root and superior cervical ganglia, clinically manifesting primarily as facial herpes. HSV-2, on the other hand, is mainly transmitted through sexual behavior and genital contact, so it commonly remains latent in the sacral ganglia, leading to clinical manifestations of genital herpes. Serological tests in patients are consistently positive, and they may experience intermittent HSV activity in the urogenital tract for life.

In the initial stage of infection, the virus first replicates in the ganglia and adjacent neural tissues, then travels via sensory nerves to their endings, causing skin or mucous membrane lesions. The spread of the virus from peripheral sensory nerves to the skin and mucous membranes explains the extensive epidermal infection and the occurrence of new lesions distant from the primary site. These characteristics are often observed in primary HSV infections, and the virus has been detected in neural tissues far from the inoculation site. After the clinical symptoms of the initial infection subside, the infectious virus can no longer be isolated from the nerves, and viral proteins are undetectable on cell surfaces. Various stimuli, such as immunosuppression, fatigue, infection, psychological trauma, or trauma to the skin or ganglia, can reactivate the virus.

After the resolution of primary infection, no infectious virus or viral structural proteins are found in the ganglia. The viral genome in latently infected nerve cells differs from that in active infection: in latent infection, HSV DNA is circular, and RNA transcripts detected in the nuclei of latently infected mouse nerve cells and human trigeminal ganglia can hybridize with regions encoding the early gene ICP0. This RNA is transcribed from the complementary strand of DNA encoding ICP0. This "antisense" RNA may play a role in maintaining but not establishing latent infection in nerves. The mechanism of maintaining latent infection remains unclear, and it appears that latently infected cells only partially transcribe HSV proteins.

bubble_chart Pathological Changes

The epidermal cells undergo ballooning degeneration, with eosinophilic inclusions visible within them. The epidermis initially forms multilocular blisters due to reticular degeneration, which later coalesce into unilocular blisters. The dermal papillary layer exhibits grade I edema with varying degrees of inflammatory cell infiltration. In severe reactions, manifestations of severe vasculitis may be present.

bubble_chart Clinical Manifestations

1. Symptoms

HSV infection is a systemic disease. The virus enters the human body through the respiratory tract, oral cavity, genital mucosa, or damaged skin. It can reside in normal human mucosa, blood, saliva, local sensory ganglia, and most organs. HSV can be isolated from almost all internal organs and mucosal surfaces.

Primary infections are mostly latent, with few or no clinical symptoms, presenting as subclinical manifestations. Only a small number (about 1–10%) may exhibit clinical symptoms. This is mainly seen in immunocompromised infants, severely malnourished children, or those with other infections, and is rare in adults. After the primary infection subsides, the virus can remain latent in the body. Over half of normal individuals are carriers of the virus, which can spread through oral or nasal secretions, becoming a source of contagion. Since HSV does not confer permanent immunity in humans, whenever the body's resistance declines—such as during febrile infectious diseases, gastrointestinal disorders, menstruation, pregnancy, localized infections, excessive fatigue, or emotional or environmental changes—the latent HSV can be reactivated, leading to symptoms.

HSV-1 primarily causes oral herpes, pharyngitis, keratoconjunctivitis, and sporadic encephalitis, while HSV-2 mainly causes genital herpes, though clinical overlap can occur.

The incubation period for HSV infection ranges from 1 to 45 days, averaging 6 days. HSV-1 infections mainly occur at the mucocutaneous junctions of the mouth corners, lips, and nostrils, but can also appear on the face or lips. Initially, there is localized burning, itching, and mild tension, occasionally accompanied by neuralgia. This is followed by erythema, on which clustered small papules develop, quickly turning into millet- to mung bean-sized vesicles with clear fluid. After the vesicles rupture, erosions form, drying into scabs after a few days. Symptoms include burning and itching, occasionally fatigue, malaise, and mild fever. Healing may leave temporary pigmentation. The entire course lasts about 1–2 weeks.

HSV-2 infections primarily occur in the genital area. The affected area first feels a burning sensation, followed by clusters of small vesicles on an erythematous base. In males, these commonly appear on the foreskin, glans, coronal sulcus, or penis, and rarely in the urethra. In females, they are often seen on the labia, clitoris, vagina, or cervix. The vesicles may gradually turn into pustules, rupturing after about 6 days to form erosions or shallow ulcers, accompanied by pain. Patients may develop urethritis, leading to dysuria. Many experience painful inguinal lymphadenopathy, and some may have fever, myalgia, or meningeal symptoms. In females, cervical involvement may lead to ulcerative necrosis, increased vaginal discharge, and lower abdominal pain. Cervical carcinoma should be monitored. Genital herpes during pregnancy can lead to late miscarriage, premature labor, or stillbirth, and increases the risk of neonatal herpes infection. The condition usually resolves in about 3 weeks but often recurs, typically within 1–4 months after the primary episode. Recurrences are milder and more localized, sometimes presenting with only 1–2 vesicles and lasting 8–12 days. Infections may also occur outside the genital area, such as on the lips, buttocks, or central nervous system.

2. Signs

Skin lesions appear as clusters of vesicles, pustules, erosions, or ulcers on an erythematous base. About 90% of female patients have HSV cervicitis, with redness, erosions, ulcers, and purulent vaginal discharge. Some may have tender inguinal lymphadenopathy or elevated body temperature. Skin lesions can also appear on the lips, fingers, buttocks, thighs, arms, or even the eyes and throat. Complications like meningitis or transverse myelitis may occur 3–12 days after the rash, presenting with signs of increased intracranial pressure such as neck stiffness.

3. Latent Infection and Recurrence

Approximately one week after HSV infects the human body, neutralizing antibodies appear in the blood, peaking at 3–4 weeks and persisting for many years. These antibodies can clear the virus and aid in recovery, but most individuals cannot completely eliminate the virus or prevent recurrence, allowing the virus to persist in a latent state within the host. The clinical course of acute primary genital herpes is similar among individuals infected with different HSV subtypes, but the recurrence rates of genital lesions vary. About 90% of individuals with primary HSV-2 infection experience at least one recurrence within 12 months (averaging four recurrences), whereas only 50% of those with primary HSV-1 infection experience similar recurrences (averaging less than one recurrence). The recurrence rate of genital HSV-2 infection varies widely among individuals and even within the same patient over their lifetime, with most experiencing 5–9 recurrences per year, typically occurring 1–4 months after the primary herpes subsides. Some patients experience recurrences triggered by factors such as fever, menstruation, sun exposure, cold, or certain viral infections. A characteristic feature is that recurrences often occur at the same site, sometimes preceded by prodromal symptoms like localized cutaneous pruritus, burning, or tingling sensations at the infection site hours before the eruption.

Recurrent genital herpes (GH) has a significant psychological impact on patients. Due to the lack of effective therapies to prevent recurrence and the potential risk of inducing genital malignancy, it causes psychological distress. Many patients experience psychological barriers such as depression and fear, which directly contribute to HSV recurrence. Based on our treatment experience, as long as patients adhere to regular treatment, a cure can be achieved.

IV. HSV and HIV Infection:

HSV often co-infects with HIV-1 and can accelerate disease progression, leading to severe local and disseminated infections. Currently, HSV is considered a regulatory factor that can activate HIV replication. Heng performed skin biopsies on six AIDS patients with genital HSV skin lesions and found that keratinocytes and macrophages contained hybridized HIV-1 and HSV-1, which allowed HIV-1 to retain its infectivity and enter cells without binding to CD4 molecules. Additionally, HSV-1 can stimulate latent HIV-1, increasing HIV-1/HSV-1 co-infection and replication in tissues.

bubble_chart Diagnosis

The diagnosis of HSV infection is based on medical history, clinical manifestations, and laboratory test results. A history of unprotected sexual intercourse, along with the appearance of skin erythema and primary vesicles in the genital area, and a tendency for recurrence, makes the diagnosis relatively straightforward. When necessary, vesicle fluid smears, culture, inoculation, immunofluorescence tests, and serum immune antibody assays can be performed, all of which aid in diagnosis and determining the virus type.

1. Cytological Methods

Scrapings from skin lesions can be stained with Wright-Giemsa (Tzanck test) or Papanicolaou stain to detect multinucleated giant cells with inclusions characteristic of HSV infection. However, this method cannot differentiate between HSV infection and varicella-zoster virus infection, and its sensitivity is only 60% compared to viral isolation.

2. Culture Method

Viral culture from the base of vesicles is currently the most sensitive and specific diagnostic method, requiring 5–10 days. Due to its high technical requirements and cost, it is not widely used.

3. Antibody Detection

The most widely used method is HSV-2 antibody detection, such as Western blot, which can also use gD2 as an antigen to detect HSV-2 antibodies. This method is sensitive and can distinguish between HSV-1 and HSV-2.

4. Genetic Diagnosis

(1) PCR Typing for Herpes Simplex Virus

PCR is a highly sensitive, specific, and rapid detection method. It can detect as little as 1 fg of HSV-DNA and has advanced rapidly in HSV infection diagnosis. Typing HSV is a growing trend.

1. Specimen Collection and Processing

(1) Specimen Collection

① Cerebrospinal fluid (CSF): Collect 0.5 mL of CSF directly into a sterile tube. If blood is visible, centrifuge and use the supernatant.

② Amniotic fluid and infant serum: Same as above, avoiding hemolysis.

③ Brain tissue: Autopsy or biopsy specimens are ground with 1 mL of PBS buffer and stored for testing.

④ Eye and skin lesion secretions: Use pre-moistened swabs to collect secretions and place them in 1 mL of PBS buffer for testing.

⑤ Genital specimens (cervix, vagina, vulva, penis): Clean the lesion surface with a sterile swab, then use a pre-moistened swab to collect secretions and place them in 1 mL of PBS buffer for testing.

(2) Specimen Processing

① Preprocessing: Liquid specimens can be directly prepared for templates. Alternatively, centrifuge 100 μL of specimen at 5,000 rpm for 5 min, discard the supernatant, and use the pellet for template preparation.

② Template preparation: a: Proteinase K digestion: Add 100 μL of Proteinase K lysis buffer to the pellet, incubate at 55°C for 1 h, boil for 10 min, centrifuge at 5,000 rpm for 5 min, and collect the supernatant. b: Boiling method: Add 100 μL of distilled water to the pellet, mix, boil for 20 min, centrifuge at 5,000 rpm for 5 min, and collect the supernatant. c: 1% Triton X-100 lysis: Add 1 μL of Triton X-100 to 100 μL of specimen, boil for 20 min, centrifuge at 5,000 rpm for 5 min, and collect the supernatant. d: 5% NP-40 lysis: Add 5 μL of NP-40 to 100 μL of specimen, boil for 20 min, centrifuge at 5,000 rpm for 5 min, and collect the supernatant. e: For severely hemolyzed specimens, after lysis, perform phenol-chloroform extraction, precipitate DNA with cold ethanol, and dissolve in 10 μL of DW for testing.

2. PCR Amplification

(1) Primer design. The highly conserved region of the HSV DNA polymerase was selected as the target sequence to ensure specificity. Three primers were designed: one common upstream primer, DNAP5 (5′ATGGTGAAAACATCGACATGTACGG3′), and two downstream-specific primers, DNAP3-1 (5′CCTCGCGTTCGTCCTCGTCCTCC3′) and DNAP3-2 (5′CCTCCTTGTCGAGGCCCCGAAAC3′). These primers can amplify a 469bp DNA fragment of HSV-1 (1981–2359) and a 391bp fragment of HSV-2 (1561–1953), respectively. Additionally, a type-independent specific probe, HSVP3 (5′GGCGTAGTAGGCGGGGATGTCGCG3′), was designed from the PCR amplification products of both types.

(2) PCR reaction system. Take 10μl of template: DNAP5 0.5 (0.2μmol/L): DNAP3-1 0.5μl (0.2μmol/L): DNAP3-2 0.5μl (0.2μmol/L): 4×dNTP 8μl (4×200μmol/L): 10×dNTP 8μl (4×200μmol/L); 10× buffer 10μl: DMSO 4μl; add DW 65.5μl; mineral oil 30μl.

3. Detection and analysis of amplification products

(1) Agarose gel electrophoresis staining method: Take 20μl of amplification product and mix with 4μl of sample buffer, then load onto a 2% agarose gel plate. Electrophorese at 70V for 15～20min, stain with ethidium bromide (EB) for 5min, and observe the results under UV light. One or two bright red bands behind the bromophenol blue indicate a positive result (HSV-2 band in front, HSV-1 band behind), while no band indicates a negative result.

(2) XhoI restriction enzyme mapping: Take 50μl of HSV-1 PCR product and add 50U of XhoI, incubate at 37℃ for 1h, then place in 3% agarose gel and electrophorese at 70V for 15～20min. A 46bp fragment band (behind the primer) will be produced. Compared with normal PCR products, the larger fragment after XhoI digestion will migrate further in electrophoresis.

(3) Southern blotting: After electrophoresis of 20μl PCR product, treat with denaturation solution for 60min, then neutralize for 90min, and transfer to nitrocellulose membrane. Bake the membrane at 80℃ for 2h, pre-hybridize at 42℃ (in hybridization solution) for 30min, add 32P-labeled HSVP3 probe, and hybridize overnight at 42℃. The next day, wash with 1% SDS/PBS pH7.2 at 42℃ for 15min, then with 0.5% SDS/PBS pH7.2 at 42℃ for 15min. Place the membrane in an X-ray cassette for autoradiography for 12～15h. Development indicates a positive result, while no development indicates a negative result.

(B) Nested PCR

Nested PCR (nested primers-polymerase chain reaction, NP-PCR) utilizes two sets of primers: an "outer" pair that amplifies a larger DNA fragment and an "inner" pair located within the amplified product to further amplify a smaller fragment. This two-step consecutive amplification enhances the sensitivity of PCR detection and ensures the specificity of the product. However, this method cannot differentiate types, detecting HSV-1 with 100% accuracy but only 50% for HSV-2. Improvements in typing detection for HSV are needed to better promote its application in clinical practice and basic research.

1. Sample Processing:

(1) Sample collection same as above

(2) DNA preparation: ① Cerebrospinal fluid (CSF): Take 100μl CSF, boil for 15 min, add 250μl absolute ethanol, store at -30℃ for 10 min; centrifuge at 10000g for 30 min, discard supernatant, dry at 30℃, then add 10μl DW; ② Brain tissue cells: Take the precipitate, add 100μl proteinase K digestion lysis buffer, incubate at 56℃ for 1h, boil for 10 min; take the supernatant, add an equal volume of phenol-chloroform (V/V), shake gently for 10 min, centrifuge at 10000r/min × 10 min; take the aqueous phase, add 250μl DW to dissolve.

2. PCR Amplification

(1) Primer design: Select the HSV1 glycoprotein D gene as the target gene for detection.

NP-PCR primer and probe sequences

(2) PCR experimental system and procedure: The reaction volume is 50μl; template 10μl; BJHSV1.1 0.5μl (0.2pmol/L); BJHSV1.2 0.5μl (0.2pmol/L); 10× buffer 5μl; 4× dNTP 4μl (4×200mmol/L); DW 27μl; mineral oil 30μl. The cycling parameters are 95℃ for 30s; 55℃ for 30s; 72℃ for 60s; 20 cycles, then take 1μl of the amplified product and add it to the reaction system containing BJHSV1.3 and BJHSV1.4 for nested amplification. First, denature at 95℃ for 2min, then cycle with parameters of 95℃ for 30s; 55℃ for 30s; 72℃ for 60s; 30 cycles, followed by extension at 72℃ for 5 min.

(3) Analysis of amplification products:

① Agarose gel electrophoresis staining method:

Take 10μl of the amplified product and load it onto a 2% agarose gel, run electrophoresis at 70V for 15～20min, stain with ethidium bromide for 5min, and observe the results under UV light. One or two bright red bands behind the bromophenol blue indicate a positive result, with the HSV-2 band in front and the HSV-1 band behind. No bands indicate a negative result.

② Southern blotting method:

After electrophoresis of 20μl PCR product, treat with denaturing solution for 60min, then neutralize with neutralizing solution for 90min, transfer to a nitrocellulose membrane, bake the membrane at 80℃ for 2h, pre-hybridize (in hybridization solution) at 42℃ for 30min, add 32P-labeled HSV probe, and hybridize overnight at 42℃. The next day, wash with 1% SDS/PBS pH7.2 at 42℃ for 15min, then with 0.5% SDS/PBS pH7.2 at 42℃ for 15min; place the membrane in an X-ray cassette and autoradiograph for 12～15h. Development indicates a positive result, while no development indicates a negative result.

(III) Polymerase chain reaction-endonuclease cleavage (PCR-EC)

It has the characteristics of being economical and widely applicable; it can not only simultaneously detect and differentiate four viruses—HSV-1, HSV-2, EBV, and CMV—in a single test, but the method itself is also fast, convenient, free from radioactive injury, and easily accepted by laboratories. It can detect as few as 3 CFU of HSV-1, demonstrating high sensitivity, and is capable of identifying HSV DNA-positive results in CSF from the first day of central nervous system infection. Additionally, it can be used to evaluate the effectiveness of drug treatments. Due to the variability of viruses, mutations may lead to the loss of enzyme restriction sites, resulting in false-negative restriction results. This issue can be resolved using type-specific probes or sequence analysis.

1. Specimen Processing

(1) Specimen collection: same method as above.

(2) DNA template preparation: Take 200μl of each specimen, add protease K at 200μg/ml, incubate at 56°C for 1h;

Add an equal volume of phenol-chloroform (v/v), gently shake for 10min, centrifuge at 1000r/min × 5min; take the aqueous phase, add 500μl (2.5 times volume) of anhydrous ethanol, precipitate DNA at -20°C overnight, centrifuge at 15000r/min × 5min, remove the liquid, dry at 30°C, then dissolve in 25μl of distilled water, and store for testing.

2. Primer Design:

P1, 1′CGACTTTGCCAGCCTGTACC3′

P2, 2′AGTCCGTGTCCCCGTAGATG3′

(1) PCR reaction system:

Reaction volume 100μl; template 10μl; P1 0.5μl (10pmol/L), P2 0.5μl (10pmol/L); 4×dNTP 4μl (4×200mmol/L); 10× buffer 10μl, DMSD 5μl, DW 65μl. Cycling parameters: 94°C 60s; 60°C 60s; 72°C 60s; 40 cycles; 72°C extension for 4min.

(2) Amplification product detection and restriction enzyme typing.

① First-step electrophoresis identification: Take 10μl of PCR product, add 4μl of sample buffer, load onto a 2% agarose gel, electrophorese at 70V (5-20min), stain with EB for 5min, observe under UV light to preliminarily determine the size of the amplified product.

② Restriction enzyme analysis: Take 20μl of PCR product into two Eppendorf tubes, add 50μl of anhydrous ethanol, precipitate DNA at -20°C, then dissolve in 20μl of Smal and BamHI reaction buffers, respectively, add 50U of SmaI or BamHI to the corresponding Eppendorf tubes, incubate at 37°C for 1h.

③ Second-step electrophoresis typing: Take 10μl of PCR digest, add 4μl of sample buffer, load onto a 2% agarose gel, electrophorese at 70V for 15-20min, stain with EB for 5min, and compare with the undigested PCR product added simultaneously. Observe under UV light, results as follows:

PCR-EC method detection results for four viruses

(IV) Detection of Herpes Simplex Virus by RT-PCR

RNA polymerase chain reaction (RNA-PCR) can detect RNA from different stages of HSV, which not only aids in diagnosing HSV infection but also facilitates in-depth research into the latent infection mechanism of HSV.

RT-PCR uses RNA as a template to generate cDNA through reverse transcription (RT), followed by PCR amplification using cDNA as the template for detection purposes. Therefore, RNA-PCR can also be referred to as RT-PCR.

1. Sample Processing:

Total RNA extraction from tissue block cells: Take 100mg of tissue sample, add 1ml of guanidinium thiocyanate denaturing solution, homogenize in a homogenizer at room temperature, then transfer to a 2.5ml Eppendorf tube. Sequentially add 0.1ml of 3mol/L (pH4.0) NaAc, 1ml of water-saturated phenol, and 0.2ml of chloroform-isoamyl alcohol, mix well, shake vigorously for 10s, and place on ice for 15min. Centrifuge at 10000g, 4°C for 20min, take the clear aqueous phase (upper DNA, lower DNA, and denatured proteins), add an equal volume of isopropanol, and store at -20°C for 1h to precipitate RNA. Centrifuge at 15000r/min for 10min, discard the supernatant, dissolve the RNA in 0.3ml of guanidinium thiocyanate denaturing solution, then add 0.3ml of isopropanol to precipitate again, store at -20°C for 1h to precipitate RNA. Centrifuge at 15000r/min for 10min, discard the supernatant, wash the RNA pellet once with 75% cold ethanol, and vacuum dry. Dissolve in 10μl of TE buffer (pH7.4), store at low temperature for later use. Thaw on ice before use.

2. PCR Amplification:

(1) Primer Design: Select the HSV-1 ICPO gene (immediate early) as the target gene for detection. Design 2 primers:

P1 5′GGATCCTCACGTGGTTACCCGCGGTCT 3′

P2 5′AAGCTTCCGGGGCCGTCCCCGCGGGCG 3′ can amplify a 266bp sequence in ICPO.

1 probe: 5′CCGGCTGGAGCCGCCGCACCCTGCT3′.

(2) PCR Reaction System: Total reaction volume is 50μl, template 10μl (0.25～1.0μg), P1 1μl (20pmol/L); P2 1μl (20pmol/L); 4×dNTP 4μl (200μmol/L); 10×buffer 5μl; AMV (reverse transcriptase) 2μl (50U); DW 26μl; Cycling parameters: denature at 94°C for 2min, then 94°C for 50s, 60°C for 60s, 72°C for 60s, for 40 cycles, followed by extension at 72°C for 5min.

3. Identification of Amplification Products:

(1) Agarose gel electrophoresis staining method: Take 10μl of PCR amplification product, add 4μl of sample buffer, mix well, load onto a 2% agarose gel, run at 70V for 15～20min, stain with EB for 5min. Observe the amplification bands under UV light.

(2) Southern blot hybridization: The PCR products were detected using a 32P-labeled specific probe, with the same method as described above.

In summary, in the clinical diagnosis of HSV infectious diseases, PCR can amplify and detect specific target DNA fragments of HSV during the provirus or latent low-replication stages. It is far more sensitive than DNA probes and can detect the virus even before antibodies appear in the serum. Therefore, PCR holds broad prospects both as a fundamental research tool and as a clinical diagnostic method.

5. Histopathological Diagnosis

Intracellular edema, formation of large blisters in the basal layer, infiltration of multinucleated giant cells around the lesion, particularly with multinucleated white blood cells and lymphocytes densely filling the central area of the lesion.

bubble_chart Treatment Measures

The disease is self-limiting and usually resolves on its own within 1 to 2 weeks. The goal of treatment is to prevent future recurrences. There is currently no specific medication for this condition, and the treatment principles are to shorten the course of the disease, prevent secondary infections, and reduce recurrences.

1. Local therapy: The principle is to dry, astringe, and protect the affected area to prevent secondary infections. Options include topical application of 2% Chinese Gentian Violet solution, or alternatives such as 10% Nutgall Bismuth (Dermatol), zinc oxide ointment or paste, Arnebia Unprocessed Rehmannia Root elm ointment, 0.5% neomycin ointment, 0.25%~0.1% idoxuridine (IDU) ointment, or 5% idoxuridine dimethyl sulfoxide solution (for skin herpes). For facial lesions, 10% aluminum acetate or zinc-copper compound can also be used.

2. Systemic therapy: The treatment principles are to prevent the activation of HSV infection or even eliminate the virus, and to modulate the immune system to prevent recurrence. Options include intravenous or oral acyclovir, oral Lizhuwei, intramuscular interferon, or intramuscular interleukin-II. In treating recurrent genital herpes, we used 3 million units of interferon produced by the Fourth Military Medical University Biotechnology Center, administered intramuscularly once daily for 10 days per course, totaling three courses. This was combined appropriately with interleukin-II, Libaiduo, or Bacillus prodigiosus, resulting in 95% of patients experiencing no recurrence.

Below are other herpes treatment methods for reference:

I. Anti-HSV medications

(1) Acyclovir is a recognized effective drug:

1. Primary and initial infection: ACV 200mg, five times daily for 7 days; or ACV 5mg/kg, intravenous injection by body weight, every 8 hours for 5–7 days.

2. Recurrent infection: ACV 200mg, five times daily for 5 days, or ACV 800mg, twice daily for 5 days. If treatment begins during the prodromal phase or within 2 days of lesion appearance, it may be effective for some patients.

3. Frequent recurrence: ACV 200mg, three times daily, can be taken continuously for 6–12 months. In patients with frequent recurrences (>6 times per year), daily treatment can reduce recurrence rates by at least 75%. Long-term treatment for up to 3 years has been confirmed as safe and effective. ACV-resistant HSV strains have been isolated from treated populations, but no treatment failures have been observed in immunocompetent individuals. Treatment should be discontinued after 1 year to reassess the patient's recurrence rate.

4. Immunocompromised patients: For acute primary or recurrent cases, intravenous ACV (5mg/kg/8h) or oral ACV 400mg four times daily for 7–10 days; for suppression, daily intravenous ACV (5mg/kg/8h) or oral ACV (400mg three to five times daily) can prevent recurrence.

5. HSV proctitis: ACV 400mg five times daily can shorten the course. Immunocompromised or severe cases may receive intravenous ACV 5mg/kg/8h.

6. Neonatal HSV: Current data suggest that asymptomatic infants infected via the birth canal should not routinely receive ACV treatment. Treatment is limited to infants with clinical HSV manifestations or positive postpartum viral cultures. All neonatal HSV infections should be treated with ACV or vidarabine. Common regimens include ACV 300mg/kg/day or vidarabine 30mg/kg/day, intravenously for 10–14 days.

7. Co-infection with HIV: Patients require intermittent or daily oral ACV suppression therapy. Increasing the ACV dose is highly beneficial for those co-infected with HIV.

ACV 400mg, orally, 3 to 5 times daily, is effective and should be continued until clinical symptoms disappear; for severe cases, ACV should be administered intravenously. For critically ill patients with suspected or confirmed ACV-resistant strains, the optimal regimen may be: ACV 400mg/kg, intravenous injection, every 8 hours until clinical recovery.

There is an increasing number of cases where large doses of ACV fail to respond in HIV-infected individuals with skin injuries and mucosal HSV infections. While high-dose ACV may aid in the healing of injuries for some patients, it cannot halt disease progression in others. For those with frequent recurrences, long-term ACV use does not prevent continued viral shedding, thus still posing a risk of infecting sexual partners. In such cases, switching to antiviral drugs with different mechanisms of action, such as foscarnet and vidarabine, may be effective.

The antiviral mechanism of ACV involves its easy phosphorylation by HSV-encoded thymidine kinase, forming ACV-MP, which is then converted to ACV-TP by cellular kinases. ACV-TP competes with dGTP to inhibit viral DNA synthesis.

When ACV is used systemically to treat the first clinical episode or as a suppressive therapy, it can control the symptoms and signs of herpes outbreaks. However, the drug neither eradicates latent viral infections nor affects the frequency or severity of future outbreaks. Topical treatment with ACV is less effective than oral administration and is therefore not recommended.

ACV can shorten the course of genital herpes, accelerate healing, and alleviate symptoms. Long-term use reduces recurrences. One study involving 11,000 immunocompetent individuals with genital herpes treated continuously for five years showed a significant reduction in recurrence rates during that period.

However, long-term oral ACV cannot eliminate latent virus in the sacral ganglia, and genital herpes may still recur after discontinuation. Strains of virus resistant to ACV are becoming increasingly common, with nearly all resistant cases occurring in immunocompromised individuals who have undergone multiple treatment courses.

The main side effect of intravenous ACV is transient renal insufficiency caused by drug crystallization in the renal medulla. This side effect can be avoided by slow infusion over at least one hour or by drinking plenty of fluids.

(2) Ribavirin (RBV): Inhibits the replication and synthesis of various viral DNAs and RNAs.

Dosage: For primary genital herpes and HSV infections in AIDS patients, 15 mg/kg/day intramuscularly; for recurrent genital herpes, 0.4 g orally four times daily for three days, then 0.4 g twice daily for five days. This regimen is effective and can be used for drug-resistant viral strains.

(3) Foscarnet (PFA): Selectively inhibits herpesvirus-induced DNA-dependent DNA polymerase, primarily used for ACV-resistant viral strains.

Dosage: 40–60 mg/kg/day intravenously every eight hours for four doses, applicable for HSV infections in AIDS patients. Topical 0.3–1% PFA cream can also be used. Side effects include nephrotoxicity and calcium-phosphorus metabolism disorders.

(4) Ganciclovir (DNPG): A derivative of ACV that inhibits viral DNA replication, thereby blocking RNA synthesis. The target site is the DNA polymerase of infected cells.

Dosage: 5–10 mg/kg/day intravenously in three divided doses for 14 days. Side effects include hematopoietic suppression and liver damage.

(5) FIAC: Equally effective against HSV-1 and HSV-2, selectively targeting virus-infected cells. Its metabolites, 5-iodouracil and 5-methyluracil, also exhibit antiviral activity. Vidarabine phosphate inhibits viral DNA synthesis with broad-spectrum antiviral effects and minimal side effects. While it cannot prevent latent infection, it offers some protective effect against viral entry into the central nervous system. Topical application of anti-HSV monoclonal antibodies has therapeutic effects on genital herpes, with foreign reports indicating a total efficacy rate of 92.6% and a complete cure rate of 44.1% for HSV-2.

(6) Indomethacin: Its action is to inhibit prostaglandin synthesis, which helps reduce GH recurrence, promotes cell proliferation stimulated by conA and PHA (phytohemagglutinin), and enhances the killing ability of NK cells. It can be used for the treatment of recurrent GH. Dosage: 25mg orally, three times daily.

(7) Polyinosinic-polycytidylic acid (Poly ZIC): A synthetic interferon inducer that stimulates phagocytosis, enhances antibody formation, and regulates the immune system. Dosage: 2mg, intramuscular injection, 2-3 times per week.

II. Management of GH during pregnancy

The safety of acyclovir (ACV) use in pregnant women has not been definitively established. However, studies have found no increased incidence of teratogenicity in pregnant women using ACV compared to the general population. Nevertheless, the risks of ACV to pregnancy and the fetus have not yet been conclusively determined.

For life-threatening HSV infections in the mother, such as encephalitis, pneumonia, or hepatitis, intravenous ACV should be administered. However, for non-life-threatening HSV infections, systemic ACV treatment is unnecessary.

According to recommendations from the American Society for Infectious Diseases, the management plan for recurrent GH during pregnancy is as follows:

(1) If there are no active genital lesions at the time of childbirth, cesarean delivery is not required;

(2) In the last three months of pregnancy, symptomatic recurrences are brief. As long as there are no active lesions at the time of childbirth, vaginal delivery is permissible.

(3) If active GH is present during labor, the following measures may be taken: ① If the amniotic membrane is intact, the mother is afebrile, and the fetus is not yet mature, childbirth should be delayed; ② If the pregnancy is full-term, the amniotic fluid has ruptured, and the fetal lungs are mature, a cesarean section should be performed.

bubble_chart Prevention

(1) Avoid unclean sexual intercourse and improper sexual relationships. Individuals with active genital herpes are strictly prohibited from having sexual relations with anyone;

(2) Refrain from sexual activity during the treatment period. If necessary, the spouse should also undergo examination;

(3) For the care of local lesions, maintain cleanliness and dryness to prevent secondary infections;

(4) After recovery or in cases of recurrence, pay attention to preventing triggers such as common cold, catching a chill, or overexertion to reduce the likelihood of recurrence.

Currently, there is no specific preventive method. Animal experiments have shown that vaccination with HSV inactivated or attenuated live vaccines provides immune effects. However, due to the close relationship between the virus and certain cancers, these vaccines are not routinely used for prevention. Recently, purified herpesvirus membrane glycoproteins have been used as vaccines, which can avoid the carcinogenic risks associated with herpesvirus DNA.

ACV also has a preventive effect. Condoms may reduce disease transmission, especially during asymptomatic viral shedding, but when genital lesions are present, condom use cannot completely prevent transmission.

bubble_chart Differentiation

Mainly differentiated from hard chancre and soft chancre: hard chancre is a single, firm ulcer, painless, with no history of recurrence, laboratory tests show USR (+) or RPR (+), and Treponema pallidum can be observed. Soft chancre is a soft ulcer, locally painful but with no history of recurrence, and laboratory tests show positive for Haemophilus ducreyi.

Other genital skin diseases such as contact herpes zoster and Behçet's disease. Impetigo may sometimes resemble genital herpes but can be distinguished based on medical history and examination.